This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCI-TPI_WT-IL6_3UTR-xrRNA-4H
catalog :
108373
citations: 1
Reference
Boehm V, Gerbracht J, Marx M, Gehring N. Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Nat Commun. 2016;7:13691 pubmed publisher
product information
Catalog Number :
108373
Product Name :
pCI-TPI_WT-IL6_3UTR-xrRNA-4H
article :
doi10.1038/ncomms13691
id28192900
pubmed_id27917860
bacterial resistance :
Ampicillin
cloning :
backbonepCI-neo
backbone_mutation
backbone_originPromega
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid
growth strain :
Expresses wild type TPI reporter; contains partial IL6 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3NotI
cloning_site_5NheI
promoterCMV
sequencing_primer_3TGCATTCTAGTTGTGGTTTGTC
sequencing_primer_5GGTGTCCACTCCCAGTTCA
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesHEL-S-49, TIM, TPI, TPID
geneTPI1
id7167
aliasesBSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6
geneIL6
id3569
genbank_ids
mutation
nameWild type TPI reporter with partial IL6 control 3' UTR, MVE xrRNA and 4H probe binding sites
shRNA_sequence
size
species
9606
Homo sapiens
32644
Other
tags
resistance markers :
2381
tags :
High Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA