This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pIRESneo-FLAG/HA Ago2 corrected
catalog :
10822
citations: 42
Reference
Yang A, Bofill De Ros X, Stanton R, Shao T, Villanueva P, Gu S. TENT2, TUT4, and TUT7 selectively regulate miRNA sequence and abundance. Nat Commun. 2022;13:5260 pubmed publisher
Siebenaler R, Chugh S, Waninger J, Dommeti V, Kenum C, Mody M, et al. Argonaute 2 modulates EGFR-RAS signaling to promote mutant HRAS and NRAS-driven malignancies. PNAS Nexus. 2022;1:pgac084 pubmed publisher
Wang H, Tian Z, Xu Y, Wang Q, Ding S, Li Y. Altering Intracellular Localization of the RNA Interference Factors by Influenza A Virus Non-structural Protein 1. Front Microbiol. 2020;11:590904 pubmed publisher
Shin E, Jin H, Suh D, Luo Y, Ha H, Kim T, et al. An alternative miRISC targets a cancer-associated coding sequence mutation in FOXL2. EMBO J. 2020;:e104719 pubmed publisher
Ciesiolka A, Stroynowska Czerwinska A, Joachimiak P, Ciolak A, Kozlowska E, Michalak M, et al. Artificial miRNAs targeting CAG repeat expansion in ORFs cause rapid deadenylation and translation inhibition of mutant transcripts. Cell Mol Life Sci. 2020;: pubmed publisher
Gómez Acuña L, Názer E, Rodríguez Seguí S, Pozzi B, Buggiano V, Marasco L, et al. Nuclear role for human Argonaute-1 as an estrogen-dependent transcription coactivator. J Cell Biol. 2020;219: pubmed publisher
Yang A, Shao T, Bofill De Ros X, Lian C, Villanueva P, Dai L, et al. AGO-bound mature miRNAs are oligouridylated by TUTs and subsequently degraded by DIS3L2. Nat Commun. 2020;11:2765 pubmed publisher
Adiliaghdam F, Basavappa M, Saunders T, Harjanto D, Prior J, Cronkite D, et al. A Requirement for Argonaute 4 in Mammalian Antiviral Defense. Cell Rep. 2020;30:1690-1701.e4 pubmed publisher
Sharma N, Majerciak V, Kruhlak M, Yu L, Kang J, Yang A, et al. KSHV RNA-binding protein ORF57 inhibits P-body formation to promote viral multiplication by interaction with Ago2 and GW182. Nucleic Acids Res. 2019;47:9368-9385 pubmed publisher
Kaczmarczyk L, Bansal V, Rajput A, Rahman R, Krzyżak W, Degen J, et al. Tagger-A Swiss army knife for multiomics to dissect cell type-specific mechanisms of gene expression in mice. PLoS Biol. 2019;17:e3000374 pubmed publisher
Sheu Gruttadauria J, Pawlica P, Klum S, Wang S, Yario T, Schirle Oakdale N, et al. Structural Basis for Target-Directed MicroRNA Degradation. Mol Cell. 2019;75:1243-1255.e7 pubmed publisher
Liu X, Fu Q, Li S, Liang N, Li F, Li C, et al. LncRNA FOXD2-AS1 Functions as a Competing Endogenous RNA to Regulate TERT Expression by Sponging miR-7-5p in Thyroid Cancer. Front Endocrinol (Lausanne). 2019;10:207 pubmed publisher
Tang Y, Wu B, Huang S, Peng X, Li X, Huang X, et al. Downregulation of miR‑505‑3p predicts poor bone metastasis‑free survival in prostate cancer. Oncol Rep. 2019;41:57-66 pubmed publisher
Sun G, Wang J, Huang Y, Yuan C, Zhang K, Hu S, et al. Differences in silencing of mismatched targets by sliced versus diced siRNAs. Nucleic Acids Res. 2018;46:6806-6822 pubmed publisher
Sun D, Wang X, Sui G, Chen S, Yu M, Zhang P. Downregulation of miR-374b-5p promotes chemotherapeutic resistance in pancreatic cancer by upregulating multiple anti-apoptotic proteins. Int J Oncol. 2018;: pubmed publisher
Xu M, Xiao J, Chen M, Yuan L, Li J, Shen H, et al. miR?149?5p promotes chemotherapeutic resistance in ovarian cancer via the inactivation of the Hippo signaling pathway. Int J Oncol. 2018;52:815-827 pubmed publisher
van der Veen A, Maillard P, Schmidt J, Lee S, Deddouche Grass S, Borg A, et al. The RIG-I-like receptor LGP2 inhibits Dicer-dependent processing of long double-stranded RNA and blocks RNA interference in mammalian cells. EMBO J. 2018;37: pubmed publisher
Wa Q, Li L, Lin H, Peng X, Ren D, Huang Y, et al. Downregulation of miR?19a?3p promotes invasion, migration and bone metastasis via activating TGF?? signaling in prostate cancer. Oncol Rep. 2018;39:81-90 pubmed publisher
Harwig A, Kruize Z, Yang Z, Restle T, Berkhout B. Analysis of AgoshRNA maturation and loading into Ago2. PLoS ONE. 2017;12:e0183269 pubmed publisher
Li X, Liu F, Lin B, Luo H, Liu M, Wu J, et al. miR?150 inhibits proliferation and tumorigenicity via retarding G1/S phase transition in nasopharyngeal carcinoma. Int J Oncol. 2017;: pubmed publisher
Golden R, Chen B, Li T, Braun J, Manjunath H, Chen X, et al. An Argonaute phosphorylation cycle promotes microRNA-mediated silencing. Nature. 2017;542:197-202 pubmed publisher
Li Y, Basavappa M, Lu J, Dong S, Cronkite D, Prior J, et al. Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells. Nat Microbiol. 2016;2:16250 pubmed publisher
Liao Y, Deng Y, Liu J, Ye Z, You Z, Yao S, et al. MiR-760 overexpression promotes proliferation in ovarian cancer by downregulation of PHLPP2 expression. Gynecol Oncol. 2016;143:655-663 pubmed publisher
Kalantari R, Hicks J, Li L, Gagnon K, Sridhara V, Lemoff A, et al. Stable association of RNAi machinery is conserved between the cytoplasm and nucleus of human cells. RNA. 2016;22:1085-98 pubmed publisher
Kos A, Klein Gunnewiek T, Meinhardt J, Loohuis N, van Bokhoven H, Kaplan B, et al. MicroRNA-338 Attenuates Cortical Neuronal Outgrowth by Modulating the Expression of Axon Guidance Genes. Mol Neurobiol. 2017;54:3439-3452 pubmed publisher
Salzman D, Nakamura K, Nallur S, Dookwah M, Metheetrairut C, Slack F, et al. miR-34 activity is modulated through 5'-end phosphorylation in response to DNA damage. Nat Commun. 2016;7:10954 pubmed publisher
Tan Z, Zheng H, Liu X, Zhang W, Zhu J, Wu G, et al. MicroRNA-1229 overexpression promotes cell proliferation and tumorigenicity and activates Wnt/?-catenin signaling in breast cancer. Oncotarget. 2016;7:24076-87 pubmed publisher
Richter H, Katic I, Gut H, Großhans H. Structural basis and function of XRN2 binding by XTB domains. Nat Struct Mol Biol. 2016;23:164-71 pubmed publisher
Yi T, Arthanari H, Akabayov B, Song H, Papadopoulos E, Qi H, et al. eIF1A augments Ago2-mediated Dicer-independent miRNA biogenesis and RNA interference. Nat Commun. 2015;6:7194 pubmed publisher
Jiang J, Zhang Y, Guo Y, Yu C, Chen M, Li Z, et al. MicroRNA-3127 promotes cell proliferation and tumorigenicity in hepatocellular carcinoma by disrupting of PI3K/AKT negative regulation. Oncotarget. 2015;6:6359-72 pubmed
De la Mata M, Gaidatzis D, Vitanescu M, Stadler M, Wentzel C, Scheiffele P, et al. Potent degradation of neuronal miRNAs induced by highly complementary targets. EMBO Rep. 2015;16:500-11 pubmed publisher
Roy Chaudhuri B, Valdmanis P, Zhang Y, Wang Q, Luo Q, Kay M. Regulation of microRNA-mediated gene silencing by microRNA precursors. Nat Struct Mol Biol. 2014;21:825-32 pubmed publisher
Chen D, Chen Z, Jin Y, Dragas D, Zhang L, Adjei B, et al. MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells. PLoS ONE. 2013;8:e80625 pubmed publisher
Huang V, Zheng J, Qi Z, Wang J, Place R, Yu J, et al. Ago1 Interacts with RNA polymerase II and binds to the promoters of actively transcribed genes in human cancer cells. PLoS Genet. 2013;9:e1003821 pubmed publisher
Martinez N, Chang H, Borrajo J, Gregory R. The co-chaperones Fkbp4/5 control Argonaute2 expression and facilitate RISC assembly. RNA. 2013;19:1583-93 pubmed publisher
Börner K, Niopek D, Cotugno G, Kaldenbach M, Pankert T, Willemsen J, et al. Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines. Nucleic Acids Res. 2013;41:e199 pubmed publisher
Geißler V, Altmeyer S, Stein B, Uhlmann Schiffler H, Stahl H. The RNA helicase Ddx5/p68 binds to hUpf3 and enhances NMD of Ddx17/p72 and Smg5 mRNA. Nucleic Acids Res. 2013;41:7875-88 pubmed publisher
Jin Y, Tymen S, Chen D, Fang Z, Zhao Y, Dragas D, et al. MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. PLoS ONE. 2013;8:e64434 pubmed publisher
Martinez N, Gregory R. Argonaute2 expression is post-transcriptionally coupled to microRNA abundance. RNA. 2013;19:605-12 pubmed publisher
Chu Y, Yue X, Younger S, Janowski B, Corey D. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Res. 2010;38:7736-48 pubmed publisher
Buchet Poyau K, Courchet J, Le Hir H, Seraphin B, Scoazec J, Duret L, et al. Identification and characterization of human Mex-3 proteins, a novel family of evolutionarily conserved RNA-binding proteins differentially localized to processing bodies. Nucleic Acids Res. 2007;35:1289-300 pubmed
Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell. 2004;15:185-97 pubmed
product information
Catalog Number :
10822
Product Name :
pIRESneo-FLAG/HA Ago2 corrected
article :
doi10.1016/j.molcel.2004.07.007
id384
pubmed_id15260970
bacterial resistance :
Ampicillin
cloning :
backbonepIRESneo
backbone_mutation
backbone_origin
backbone_size5310
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5NotI
promoter
sequencing_primer_3agctgttggggtgagtactcc
sequencing_primer_5ggtaccgagctcggatcgat
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesCASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10
geneAGO2
id27161
genbank_ids
NM_012154
mutation3 silent mutations in orf
nameArgonaute 2
shRNA_sequence
size2580
species
9606
Homo sapiens
tags
locationN terminal on insert
tagFLAG
locationN terminal on insert
tagHA
resistance markers :
536
tags :
High Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA