This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
LSB-hsa-miR-214-3p
catalog :
103353
citations: 1
product information
Catalog Number :
103353
Product Name :
LSB-hsa-miR-214-3p
article :
| doi | 10.1038/s41467-018-04575-0 |
| id | 28192107 |
| pubmed_id | 29934631 |
bacterial resistance :
Ampicillin and Kanamycin
cloning :
| backbone | Low Sensor Backbone (LSB) | ||
| backbone_mutation | |||
| backbone_origin | |||
| backbone_size | |||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
growth strain :
Used to sense miRNA activity using fluorescence based tools. hsa-miR-214-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor Comments
origin :
30
pi :
|
resistance markers :
| 855 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
