This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
LSB-hsa-miR-128-3p
catalog :
103200
citations: 1
Reference
Gam J, Babb J, Weiss R. A mixed antagonistic/synergistic miRNA repression model enables accurate predictions of multi-input miRNA sensor activity. Nat Commun. 2018;9:2430 pubmed publisher
product information
Catalog Number :
103200
Product Name :
LSB-hsa-miR-128-3p
article :
doi10.1038/s41467-018-04575-0
id28192107
pubmed_id29934631
bacterial resistance :
Ampicillin and Kanamycin
cloning :
backboneLow Sensor Backbone (LSB)
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Synthetic Biology
growth notes :
Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
growth strain :
Used to sense miRNA activity using fluorescence based tools. hsa-miR-128-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor Comments
origin :
30
pi :
alt_names
cloning
clone_methodGibson Cloning
cloning_site_3
cloning_site_5
promoterEF-1a
sequencing_primer_3
sequencing_primer_5
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesMIR128B, MIRN128-2, MIRN128B, mir-128-2, mir-128b
geneMIR128-2
id406916
genbank_ids
mutation
namehsa-miR-128-3p target
shRNA_sequence
size
species
9606
Homo sapiens
tags
resistance markers :
855
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA