product summary
Loading...
company name :
AcceGen Biotech
product type :
other
product name :
MIRacle™ rno-miR-505-5p miRNA Agomir/Antagomir
catalog :
AM5155
quantity :
2 OD, 4 OD, 50 OD(size by request)
price :
Inquiry
more info or order :
product information
Catalog Number :
AM5155
Product Name :
MIRacle™ rno-miR-505-5p miRNA Agomir/Antagomir
Product Type :
rat microRNA
Size :
2 OD, 4 OD, 50 OD(size by request)
List Price :
Inquiry
Gene ID :
rno-miR-505
Product Description :
Accession Number: MIMAT0017226 Mature Sequence GGGAGCCAGGAAGUAUUGAUGUU rno-miR-505-5p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies. Deliverables: Agomir and/or antagomir, DEPC H2O. 1 OD corresponds to 33 ug.
Storage :
-20°C
more info or order :
company information

AcceGen Biotech
277 Fairfield Road, Ste. 334
Fairfield, NJ 07004
Fairfield, NJ 07004
marketing@accegen.com
https://www.accegen.com1-862-686-2696
headquarters: USA
browse more products
- MIRacle™ rno-miR-500-3p miRNA Agomir/Antagomir | AM5156
- MIRacle™ rno-miR-205 miRNA Agomir/Antagomir | AM5238
- Xpress™ Human NOTCH1 Over-expressing Stable Cell Line | ABC-X2085
- Xpress™ Human CASP8 Over-expressing Stable Cell Line | ABC-X0499
- Xpress™ Human RAD51 Over-expressing Stable Cell Line | ABC-X2562
questions and comments