product summary
Loading...
company name :
AcceGen Biotech
product type :
other
product name :
MIRacle™ mmu-miR-666-5p miRNA Agomir/Antagomir
catalog :
AM4392
quantity :
2 OD, 4 OD, 50 OD(size by request)
price :
Inquiry
more info or order :
product information
Catalog Number :
AM4392
Product Name :
MIRacle™ mmu-miR-666-5p miRNA Agomir/Antagomir
Product Type :
mouse microRNA
Size :
2 OD, 4 OD, 50 OD(size by request)
List Price :
Inquiry
Gene ID :
mmu-miR-666
Product Description :
Accession Number: MIMAT0003737 Mature Sequence:AGCGGGCACAGCUGUGAGAGCC mmu-miR-666-5p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies. Deliverables: Agomir and/or antagomir, DEPC H2O. 1 OD corresponds to 33 ug.
Storage :
-20°C
more info or order :
company information

AcceGen Biotech
277 Fairfield Road, Ste. 334
Fairfield, NJ 07004
Fairfield, NJ 07004
marketing@accegen.com
https://www.accegen.com1-862-686-2696
headquarters: USA
browse more products
questions and comments