Labome/ExactAntigen

    synonym: CR; CRGF; CRIPTO; Cripto-1; TDGF1
    description: teratocarcinoma-derived growth factor 1
 human mouse rat 
 antibody cDNA assay kits protein/peptide siRNA/shRNA others 
Filtersremove all filters
suppliers:
AbgentCell Signaling Technology
Novus BiologicalsOriGene
ProSciR and D Systems
RocklandSanta Cruz Biotechnology
Sigma-AldrichUS Biological
reactivity: mouse human rat
clonality: monoclonal polyclonal
host: mouse chicken goat rabbit
conjugation: biotin FITC PE HRP APC
application: immunoprecipitation immunohistochemistry flow cytometry
ELISA immunocytochemistry western blot
select up to five products for comparison.
Human Cripto-1 Affinity Purified Polyclonal Ab
R and D Systems
more products
reactivity: human
clonality: polyclonal
host: goat
application: western blot
quantity: 100 ug
price: 355
to the supplier
Human Cripto-1 Allophycocyanin MAb (Clone 89633)
R and D Systems
more products
reactivity: human
clonality: monoclonal
host: mouse
conjugate: APC
application: flow cytometry
quantity: 100 Tests
price: 345
to the supplier
Human Cripto-1 Biotinylated Affinity Purified PAb
R and D Systems
more products
reactivity: human
clonality: polyclonal
host: goat
conjugate: biotin
application: western blot
quantity: 50 ug
price: 380
to the supplier
Rabbit Polyclonal Antibody against Cripto - Embryonic Stem Cell Marker
OriGene
Western blot antibodies with FREE positive controls
reactivity: human
clonality: polyclonal
host: rabbit
application: western blot
quantity: 100
price: 325
to the supplier
Anti-Cripto-1 (TDGF1)
Rockland
reactivity: rat, mouse, human
clonality: polyclonal
host: rabbit
application: immunoprecipitation, western blot, ELISA
quantity: 25 ul
price: $75.00
to the supplier
Anti-Cripto-1 (TDGF1) (Rabbit)
Rockland
reactivity: human
clonality: polyclonal
host: rabbit
application: immunoprecipitation, western blot, ELISA
quantity: 100ug
price: $245.00
to the supplier
Cripto Antibody (Mouse Specific)
Cell Signaling Technology
reactivity: mouse, human
clonality: polyclonal
host: rabbit
application: immunoprecipitation, immunocytochemistry, western blot
quantity: 100 ul
price: $214
to the supplier
Anti-TDGF1 (41-55) antibody produced in rabbit
Sigma-Aldrich
reactivity: human
clonality: polyclonal
host: rabbit
quantity:
price:
to the supplier
Anti-TDGF1 antibody produced in chicken
Sigma-Aldrich
reactivity: human
clonality: polyclonal
host: chicken
application: western blot
quantity:
price:
to the supplier
CRIPTO (TDGF1) Antibody (C-term)
Abgent
more products
reactivity: human
clonality: polyclonal
host: rabbit
application: immunohistochemistry, ELISA
quantity: 0.1 mg
price: $235
to the supplier
CRIPTO (TDGF1) Antibody (N-term)
Abgent
more products
reactivity: human
clonality: polyclonal
host: rabbit
application: immunohistochemistry, ELISA
quantity: 0.1 mg
price: $235
to the supplier
CRIPTO (TDGF1) Antibody (N-term)
Abgent
more products
reactivity: human
clonality: polyclonal
host: rabbit
application: western blot, immunohistochemistry, ELISA
quantity: 0.1 mg
price: $235
to the supplier
Cripto (CRGF, Cripto-1 Growth Factor, Cripto-3, TDGF1, TDGF2, Teratocarcinoma-derived growth factor 1) Pab Rb xMo
US Biological
more products
reactivity: mouse, human
clonality: polyclonal
host: rabbit
quantity: 100ul
price: 314.475
to the supplier
Cripto-1 (Epidermal Growth Factor-Like Cripto Protein CR1, TDGF-1, Teratocarcinoma-Derived Growth Factor 1) Pab Rb xHu
US Biological
more products
reactivity: human
clonality: polyclonal
host: rabbit
quantity: 100ul
price: 314.475
to the supplier
Cripto-1 (Epidermal Growth Factor-Like Cripto Protein CR1, TDGF-1, Teratocarcinoma-Derived Growth Factor 1, CFC-2) (Biotin) Mab Mo xHu
US Biological
more products
reactivity: human
clonality: monoclonal
host: mouse
quantity: 250ug
price: 504
to the supplier
Cripto (CR-38)
Santa Cruz Biotechnology
more products
reactivity: human
clonality: monoclonal
host: mouse
application: flow cytometry
quantity: 100 ug/ml
price: $259
to the supplier
Cripto (FL-188)
Santa Cruz Biotechnology
more products
reactivity: rat, human
clonality: polyclonal
host: rabbit
application: immunoprecipitation, immunocytochemistry, western blot, ELISA
quantity: 200 ug/ml
price: $259
to the supplier
Cripto (V-17)
Santa Cruz Biotechnology
more products
reactivity: human
clonality: polyclonal
host: goat
application: immunocytochemistry, western blot, ELISA
quantity: 200 ug/ml
price: $259
to the supplier
Cripto1 Antibody
Novus Biologicals
more products
reactivity: human
clonality: polyclonal
host: mouse
application: western blot, ELISA
quantity: 0.05ml
price: 295
to the supplier
Cripto1 Antibody - Embryonic Stem Cell Marker
Novus Biologicals
more products
reactivity: mouse, human
clonality: polyclonal
host: rabbit
application: western blot
quantity: 0.1ml
price: 295
to the supplier
Cripto1 Antibody - Embryonic Stem Cell Marker
Novus Biologicals
more products
reactivity: human
clonality: polyclonal
host: rabbit
application: western blot
quantity: 0.1ml
price: 295
to the supplier
TDGF1 Antibody
ProSci
reactivity: human
clonality: polyclonal
host: chicken
application: western blot
quantity: 0.1mg
price: 370
to the supplier

Email me when new information for the following gene becomes available: TDGF1
Webpages from suppliers
  • abgent     --- CRIPTO (TDGF1) Antibody (N-term)
  • Formalin-fixed and paraffin-embedded human colon carcinoma tissue reacted with TDGF1 antibody (N-term) (Cat. .. Teratocarcinoma-derived growth factor 1 [Precursor]; Epidermal growth factor-like cripto protein CR1; Cripto-1 growth factor; CRGF; TDGF1; CRIPTO
  • www.abgent.com/products/catalog_no/AP2047d_CRIPTO_TDGF1_Antibody_N_term    more from same supplier
  • ptglab     --- TDGF1 Antibody
  • CR;CRGF;CRIPTO;Cripto-1 .. Purified Rabbit Anti human TDGF1 PolyClonal antibody
  • www.ptglab.com/datasheet.asp?catNo=14665-1-AP    more from same supplier
  • cellsignal    
  • b>Cripto Antibody (Human Specific) .. Cripto Antibody (Mouse Specific)
  • www.cellsignal.com/pathways/angiogenesis.jsp?style=list    more from same supplier
  • origene    
  • Rabbit Polyclonal Antibody against Cripto - Embryonic Stem Cell Marker .. Homo sapiens teratocarcinoma-derived growth factor 1 (TDGF1) as transfection-ready DNA NM_003212.1
  • www.origene.com/cdna/search-nm.aspx?accn=NM_003212&species=Human&product=ALL    more from same supplier
  • creative-biomart     --- TDGF1, Fc Chimera, Recombinant Human TDGF1, Fc Chimera - Creative Biomart
  • Cat.#: TDGF1-495H .. Growth Factor 1 encoding the signal peptide and extracellular domain of human Cripto-1 (aa 1-169) was fused to the Fc region of human IgG1 (aa 90-330). .. Cripto-1 (CR-1), also known as teratocarcinoma-derived growth factor-1 (TDGF-1), is a small
  • www.creative-biomart.com/description_4669_12.htm    more from same supplier
  • genecopoeia     --- Gene: TDGF1 A0134 teratocarcinoma-derived growth factor 1
  • 6997[GeneId] .. TDGF1 .. teratocarcinoma-derived growth factor 1
  • www.genecopoeia.com/product/search/view_features.php?cid=&prod_id=A0134    more from same supplier
  • novusbio    
  • b>TDGF1 .. anti-CR antibody, anti-CRGF antibody, anti-Cripto 1 antibody, anti-Cripto-1 Growth Factor antibody, anti-Cripto-3 antibody< .. regulates invasion and migration of mouse mammary epithelial cells overexpressing Cripto-1 in vitro and in vivo[2] Normanno,N., De Luca,A., Bianco,C., Maiello,M.R., Carriero,M.
  • www.novusbio.com/data_sheet/index/NB100-75622    more from same supplier
  • neuromics     --- Cripto
  • Cancer Research Proteins .. Cripto .. DATASHEET(pdf - 135Kb)
  • www.neuromics.com/ittrium/visit?path=A1x66x1y1x9fx1y1x246x1y1x14d2x1x82y1x5e71x1x7f    more from same supplier
  • cstj     --- Cripto Antibody (Human Specific) #2020 CST 抗体
  • Cripto Antibody (Human Specific)のCSTジャパン .. Angiogenesis Cripto Antibody (Human Specific) .. 内在性レベルのヒトのCripto タンパク質を検出します。
  • www.cstj.co.jp/products/2020.html    more from same supplier
  • dundeecellproducts     --- TDGF1 293T Cell Transient Overexpression Lysate(Denatured) :: Dundee Cell Products
  • teratocarcinoma-derived growth factor 1 .. TDGF1 293T Cell Transient Overexpression Lysate(Denatured) .. CR,CRGF,CRIPTO
  • www.dundeecellproducts.com/products/abnova/details/H00006997-T01/TDGF1-293T-Cell-Transient ...    more from same supplier
  • funakoshi     --- Mouse Cripto MAb (Clone 237614)
  • It exists both as a secreted and as a GPI-anchored membrane protein. .. Monoclonal Anti-mouse Cripto Antibody ORDERING INFORMATION Preparation Catalog Number: MAB15381 This
  • www.funakoshi.co.jp/data/datasheet/RSD/MAB15381.pdf    more from same supplier
  • biorbyt    
  • Phospho MEK1 antibody .. MEK1 antibody .. CRMP2 antibody .. Calretinin antibody .. COX IV antibody .. Cripto1 antibody .. Product Cripto1 antibody successfully added to compare list
  • www.biorbyt.com/cripto1-antibody    more from same supplier
  • biologo    
  • Teratocarcinoma-derived growth factor 1 (TDGF1) .. 1 Normanno,N., et al. Cripto-1 overexpression leads to enhance..
  • www.biologo.de/englisch/standard/2583/Forschung/Y-22847.html    more from same supplier
  • australbiologicals    
  • Catalog # MR-771-4 .. Anti-mouse Cripto IgG fraction (monoclonal) .. Monoclonal Antibodies (Cancer Antigens)
  • www.australbiologicals.com/index.php?what=catalog&id=384    more from same supplier
  • springbio    
  • Cripto-1 Specification Sheet .. Home > Products > Cripto-1 .. Cripto-1 Catalog Number E18431
  • www.springbio.com/Products/Product_Detail.php?product=E18431    more from same supplier
  • diapharma    
  • Bianco, C., De Santis, M., Weitzel, H.K. and Salomon, D.S. (1999). .. Cripto #8209;1 induces phosphatidylinositol 3' #8209;kinase #8209;dependent phosphorylation of .. Cancer Res 1999 Sep 15;59(18):4502 #8209;5.
  • www.diapharma.com/support/tech_support/references/m30_cytodeath_antibody
  • ibtsystems     --- Anti-Mouse Cripto receptor: IBT Systems
  • Anti-Mouse Cripto receptor
  • www.ibtsystems.de/products/polyclonal-and-monoclonal-antibodies/miscellaneous-antibodies/c ...    more from same supplier
  • vincibiochem    
  • STELLAR .. TDGF1 Antibody .. Teratocarcinoma-derived growth factor 1, Epidermal growth factor-like cripto protein CR1
  • www.vincibiochem.it/NovitaProsci.htm
  • genetex    
  • These ligands include EGF, TGF alpha, AR, HB EGF, cripto 1, epiregulin, and betacellulin. .. A synthetic 19 mer peptide, corresponding to amino acids 8 - 26 (VKPPQNKTESENTSDKPKR)
  • www.genetex.com/WebPage/Product/ProductDetail.aspx?CatalogItemID=64249
  • medicorp    
  • Description: REC HU CRIPTO .. PHC8013
  • www.medicorp.com/web/catalog.php?cat=10&subcat=1&sup=Invitrogen&p_cat=5&page=11    more from same supplier
  • genetimes    
  • anti-cripto-1 (tdgf1) [rabbit](试剂) .. anti-cdk9 pt29 [rabbit](试剂)
  • www.genetimes.com.cn/html/acting-shangp.asp?page=176&c_name=Rockland
  • fulengen    
  • cells coexpressing GRP78 and Cripto grow much more rapidly in soft agar than do cells expressing either protein individually .. The aim was to study the activation of ATF6 and Grp78 in transfected human epithelial
  • www.fulengen.com/product/search/detail.php?prt=19&cid=&key=HQP009083    more from same supplier
  • signalchem    
  • ALK4 is able to mediate Nodal signaling in the presence of Cripto during vertebrate development (2). .. 1. Zhou, Y.
  • www.signalchem.com/product.details.php?view=cat&pID=1002&cID=8
  • bioamerica-inc    
  • gcagaggaccagagttcac 57 78 dnmt3b cacagacgacacagaggacac atcctgatactctgaactgtctcc 57 78 tdgf1 ctgcaacctccgcatccg attagctgggcatggtgacac 60. .. 536 Characterization of BG01V hESCs THIO anaerobic.
  • www.bioamerica-inc.com/pdf/library_whatman/characterization_of_a_new_nih_registered_varian ...
  • genospectra    
  • b>TDGF1 .. teratocarcinoma-derived growth factor 1
  • www.genospectra.com/index.php?id=qg2psc&page=59
browse other genes: DYNLT3, TCTE3, PPP1R11, DYNLT1, thymine DNA glycosylase


2010©Labome home | browse | about | last updated: February 19, 2010